Life Sciences, Vol. 63, No. 14, pp. PL 197-204, 1998
Copyright © 1998 Elsevier Science Inc.

PII S0024-3205(98)00390-7

PHARMACOLOGY LETTERS
Accelerated Communication

REGULATION OF d OPIOID RECEPTORS BY D 9-TETRAHYDROCANNABINOL IN NG108-15 HYBRID CELLS

Rosanna Di Toro, Gabriele Campana, Vittorio Sciarretta, Giovanna Murari and Santi Spampinato

Department of Pharmacology, University of Bologna, Irnerio 48, 40126 Bologna, Italy

(Submitted April 14, 1998; accepted April 29, 1998; received in final form July 15, 1998)


Abstract. In this study we employed the neuroblastoma x glioma NG 108-15 cell line as a model for investigating the effects of long-term activation of cannabinoid receptors on d opioid receptor desensitization, down-regulation and gene expression. Exposure of NG 108-15 cells to (-)- D 9-tetrahydrocannabinol ( D 9-THC) reduced opioid receptor binding, evaluated in intact cells, by (approximately equal to) 40 - 45% in cells exposed for 24 h to 50 and 100 nM D 9-THC and by (approximately equal to) 25 % in cells exposed to 10 nM D 9-THC. Lower doses of D 9-THC (0.1 and 1 nM) or a shorter exposure time to the cannabinoid (6 h) were not effective. Down-regulation of d opioid receptors was not observed in cells exposed for 24 h to pertussis toxin (PTX) and then treated for 24 h with 100 nM D 9-THC. In cells that were exposed for 24 h to the cannabinoid, the ability of D 9-THC and of the d opioid receptor agonist [D-Ser2, Leu5, Thr6]enkephalin to inhibit forskolin-stimulated cAMP accumulation was significantly attenuated. Prolonged exposure of NG 108-15 cells to 100 nM D 9-THC produced a significant elevation of steady-state levels of d opioid receptor mRNA. This effect was not observed in cells pretreated with PTX. The selective cannabinoid receptor antagonist SR 141716A blocked the effects elicited by D 9-THC ond opioid receptor desensitization, down-regulation and gene expression; thus indicating that these are mediated via activation of cannabinoid receptors. These data demonstrate the existence, in NG 108-15 cells, of a complex cross-talk between the cannabinoid and opioid receptors on prolonged exposure to D 9-THC triggered by changes in signaling through Gi and/or G0-coupled receptors.

Key Words: d opioid receptor, D 9-tetrahydrocannabinol, G-protein desensitization, receptor down regulation

Introduction

(-)- D 9-tetrahydrocannabinol ( D 9-THC) and the other cannabinoids constitute a class of psychoactive compounds which produce a myriad of pharmacological effects in animals and humans (1). It is well documented that these compounds exert their effects by binding to G protein-coupled receptors (2). Currently, two subtypes of cannabinoid receptors have been isolated and cloned, CB1 and CB2. The CB1 receptor is mainly distributed in the central nervous system and in several neuroblastoma-derived cell lines (3) whereas the CB2 receptor occurs predominantly in peripheral tissues (4).

In recent years, possible interactions between cannabinoid and endogenous opioid systems have been investigated on the basis that both class of compounds share several pharmacological properties, which include antinociception, sedation, hypotension and inhibition of locomotor activity (5). Cannabinoid-induced antinociception is potentiated by µ and k opioid agonists (6,7) and blocked by opioid receptor antagonists (8). Moreover, it has been reported that D 9-THC may increase prodynorphin and proenkephalin gene expression in the rat central nervous system (9,10). These interactions are further strengthened by the fact that the activation of both cannabinoid and opioid receptors can inhibit adenylyl cyclase activity, decrease calcium channel conductance and increase potassium channel conductance via pertussis toxin-sensitive G proteins of the Gi-G0 family (11-13). These findings are particularly relevant following a prolonged exposure of neuronal cells to these compounds. In fact, it has been reported that the concomitant presence of two receptors coupled to the same transduction pathway could result in a complex cross-talk between them. The prolonged binding of an agonist to one receptor would cause desensitization of effector mechanisms and decrease of receptor densities to the second receptor (14). It has been reported that micromolar concentrations of D 9-THC may inhibit, in a non competitive manner, the binding of µ and d opioid receptor ligands to rat brain homogenates (15); however, the effects of long-term activation of cannabinoid receptors on opioid receptor desensitization, down-regulation and gene expression have been poorly investigated. In this study we employed the mouse neuroblastoma x rat glioma hybridoma NG 108-15 cell as a model for studying these processes. This cell line represents a suitable model since it expresses both CB1 and d opioid receptors linked to Gi proteins (3,13).

Materials and methods

Materials. [3H]-diprenorphine (41Ci/mmol) was purchased from Amersham (Milan, Italy). The d opioid receptor agonists [D-Ser2, Leu5, Thr6]enkephalin (DSLET) and [D-Pen2, d-Pen5]-enkephalin (DPDPE) were obtained from Peninsula (Belmont, Ca). The cannabinoid antagonist SR 141716A [(N-piperidino-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-3-pyrazole-carboxamide hydrochloride] (16) was a kind gift of Sanofi Recherche (Montpellier, France). Bordetella Pertussis toxin (PTX), D 9-THC (dissolved in absolute ethanol and stored at -80°C), cell culture supplements and the other chemicals were from Sigma Chemicals (St. Louis, MO).

Cell culture and treatments. NG 108-15 cells were cultured in Dulbecco's modified Eagle's medium containing 10% (v/v) fetal calf serum and 100 UI of penicillin, 0.1 mg of streptomycin and 0.25 µg of amphotericin B/ml (defined vehicle) and maintained at 37°C in a humidified atmosphere containing 5% CO2 and 95% air. Cells were grown to (approximately equal to) 80% confluence in 75 cm2 flasks. Medium was aspirated and gently replaced before the addition of D 9-THC diluted in culture medium and added to the flasks to a final concentration ranging from 0.1 to 100 nM for 6 or 24 h. The cannabinoid antagonist SR 141716A (1 µM) was added to the cell culture medium 20 min before to add D 9-THC (100 nM) for 24 h. At the end of the incubation time, immediately before cell harvesting, D 9-THC (100 nM) was added to untreated control cells; then the medium was removed and the cells were rinsed 3 times with 10 ml of phosphate-buffered saline(PBS) to remove D 9-THC. The incubation of control cells with the cannabinoid was performed to rule out any effects that may have arisen from residual D 9-THC in the cells after washing (however, as ascertained in preliminary experiments, no differences of opioid receptor binding parameters were noted whether or not D 9-THC was added to control cells). Cells were detached from the flask surface by incubating monolayers for 5 min with PBS and using a cell scraper. Cell viability was assessed using the trypan blue dye exclusion method, and (approximately equal to) 95% of the cells showed viability in the experimental culture conditions.

Opioid receptor binding. Binding assays to intact cells in suspension were performed essentially as described by Law et al. (17) and [3H]-diprenorphine was used to label opioid binding sites at 8 different concentrations over a range of 0.1 to 10 nM. Equilibrium binding assay incubations were performed at 37°C in Krebs-Ringer-Hepes buffer (KRHB) at pH 7.4, in a final volume of 1 ml (100 µl tracer, 100 µl drug solution and 800 µl of cell suspension containing 1 x 106 viable cells). After a 20-min incubation, cells were washed with 20 ml cold KRHB by filtration on Whatman GF/B filters. Non-specific binding was determined by the addition of 1 µM DPDPE. Saturation binding data are expressed as fmol of [3H]-diprenorphine bound and normalized to the amount of cell protein, as determined by the method of Lowry (18).

cAMP accumulation. Adenylyl cyclase activity was assayed in intact cells by cAMP formation. These studies were carried out in 17-mm culture wells. Briefly, intact attached monolayer NG 108-15 cells were rinsed three times with 1 ml/well of PBS and DSLET or D 9-THC and forskolin (10 µM) were added after a preincubation period of 10 min with 0.5 mM isobutylmethylxantine and 30 µM bestatin (this latter only in experiments done with the d opioid agonist) in serum-free cell culture medium at 37°C for 15 min. The reaction was terminated with 500 µl of absolute ethanol and the cells were removed from the wells and transferred to polypropylene tubes and centrifuged (1000 g, 10 min at 4°C). The pellet was resuspended in 500 ml of ethanol/water (2 :1 ; v/v) and centrifuged again. The supernatants were dried and the cAMP content was determined by radioimmunoassay (NEN, Brussel, Belgium). Data obtained from the concentration-response curves were analyzed by non linear regression analysis (GraphPAD softaware, San Diego, CA).

Semiquantitative reverse transcriptase-PCR (RT-PCR). d opioid receptor steady-state mRNA levels were measured using a semiquantitative RT-PCR assay (19). Total RNA from NG 108-15 cells was isolated using Trizol® reagent (Life Tech., Grand Island, N.Y.) and 5 µg were reverse transcribed at 37°C using oligo(dT) primers (Stratagene, La Jolla, Ca) and Maloney murine leukemia virus-RT (Life Tech.). PCR was carried out on aliquots of cDNA (corresponding to 150 ng of total RNA) with primers (Gibco BRL, Milan, Italy) specific for the mouse d opioid receptor (GTGGTGCCGATCCTCATC and GCTTGAAGTTCTCGTCCAGG, corresponding to bases 725-742 and 1018-1037 of the mouse d opioid receptor) and for the mouse ribosomal protein L19 (forward: CTAGTGTCCTCCGCTGTGG ; reverse: AAGGTGTTTTTCCGGCATC ; product size : 190 bp) included for use as internal control. PCR was performed (28 cycles) and a chemiluminescent detection technique was employed. After performing PCR in the presence of a trace amount of digoxigenin 11-dUTP (10 µM ; Boeheringer Mannheim, Milan, Italy), the amplified products were electrophoresed on 2.0% agarose gel and transferred to a positively charged nylon membrane and exposed to x-ray film (each sample was run in triplicate) Parallel reactions conducted with 26, 28 and 30 cycles confirmed that the PCR reactions were in the linear range. As a control, each sample was also amplified by PCR without the RT step. Chemiluminescent detection was performed with a commercially available kit (Boeheringer Mannheim) and the bands were quantified using an image analyzer (Gel.Doc 1000, BIORAD). The optical density of d opioid receptor mRNA signals were normalized to those of L19 internal control.

Data analysis. Saturation binding data were analyzed by the use of the LIGAND program (20). This program utilizes a nonlinear least squares curve-fitting algorithm and assumes the simultaneous contribution of one or more independent binding sites. All possible models, in which binding parameters were either assumed to be independent, or were constrained to be equal, in the presence and absence of D 9-THC, were considered. Non-specific binding was analyzed as a fitted parameter. Curves were considered to be significantly different if the comparison of the binding parameters (i.e., Bmax or Kd ) yielded an F value significantly different (p<0.05). The other experimental data were analyzed by ANOVA followed by Duncan's multiple range test. A level of p<0.05 was accepted as statistical significant. Data are presented as the mean ± SEM of at least three different samples.

Results

Exposure of NG 108-15 cells to D 9-THC (0.1nM - 100 nM) resulted in time- and concentration-dependent decrease in opioid receptor binding evaluated in intact cells. Saturation analysis with the opioid agonist [3H]-diprenorphine gave best fits to a single site with Hill coefficients of approximately 1 and showed a significant reduction (p<0.05) of the maximal binding (Bmax) by (approximately equal to) 40-45 % in cells exposed for 24 h to 50 and 100 nM D 9-THC and » 25 % in cells exposed to 10 nM D 9-THC whereas lower doses of D 9-THC (0.1 and 1 nM) or a shorter exposure time to the cannabinoid (6 h) were not effective (Fig.1). No significant changes in the Kd values were detected (Fig.1). Down-regulation of d opioid receptors by 100 nM D 9-THC was not observed in NG 108-15 cells previously exposed for 24 h to PTX (100 ng/ml) or in presence of the cannabinoid antagonist SR 141716A (Fig.1). Cell viability was not modified by exposure up to 100 nM D 9-THC for 24 h (data not shown).

In untreated NG 108-15 cells, D 9-THC and DSLET decreased forskolin-stimulated adenylyl cyclase activity in a concentration-related manner (Fig.2). In cells that were exposed to 100 nM D 9-THC for 6 or 24 h, the ability of D 9-THC to inhibit forskolin-stimulated cAMP accumulation was significantly attenuated. This effect was not observed in cells treated with the cannabinoid (100 nM) for 24 h in presence of the antagonist SR 141716A (1 µM; added to the cell culture medium 20 min before D 9-THC) (Fig.2). DSLET was significantly less effective in suppressing forskolin-stimulated adenylyl cyclase only in cells exposed for 24 h to the cannabinoid. SR 141716A prevented the effect of the prolonged exposure of D 9-THC (100 nM for 24 h) on DSLET-induced inhibition of forskolin-stimulated adenylyl cyclase activity (Fig.2).

Exposure of NG 108-15 cells for 24 h to 100 nM D 9-THC produced a significant elevation of steady-state levels of d opioid receptor mRNA (fig.3). This effect was not observed after a 6-h incubation with the cannabinoid (data not shown) or in cells pretreated with PTX (100 ng/ml ; pretreatment was done for 24 h followed by exposure to D 9-THC) and with SR 141716A (1 mM; added to the cell culture medium 20 min before D 9-THC) and then exposed to D 9-THC for 24 h (Fig. 3).

Discussion

In this study we observed that a prolonged exposure of NG 108-15 cells to D 9-THC leads to d opioid receptor desensitization and down-regulation in addition to desensitization of the cannabinoid receptor. We ruled out the hypothesis that the decrease in opioid receptor binding was due to any non competitive interaction of D 9-THC with d opioid receptors which was reported only in the presence of relevant D 9-THC concentrations (> 1 µM) (15) higher than those employed in this study (0.1 - 100 nM). In fact, we did not observe this effect following a shorter exposure time to the cannabinoid (6 h) as well as in cells previously exposed to PTX ; thus, indicating that it is triggered by changes in signaling through Gi and/or G0-coupled receptors (3,13). Moreover, the finding that the effects elicited by D 9-THC on d opioid receptor down-regulation, desensitization and gene expression are blocked by the selective cannabinoid antagonist SR 141716A (16) adds more evidence to the hypothesis that this cannabinoid acts via specific receptors.

Fig. 1: Binding characteristics (Bmax and Kd values) of [3H]-diprenorphine in NG 108-15 cells exposed for 6 or 24 h to D 9-THC. Data show the mean ± S.E.M. of at least three separate experiments performed in duplicate. Control cells (indicated as Ve) were exposed to cell culture medium and 100 nM D 9-THC was added immediately before harvesting (see Materials and methods). Pertussis toxin (PT; 100 ng/ml) pretreatment was done for 24 h followed by exposure to D 9-THC for 24 h. The cannabinoid antagonist SR 141716A (SR ; 1 µM) was added to the cell culture medium 20 min before to add D 9-THC for 24 h. The asterisks indicate data points that are significantly different (p < 0.05) from the corresponding values found in Ve-treated cells or in cells not exposed to D 9-THC (indicated as CT; see Materials and methods).

Desensitization is an adaptive process for G-protein coupled receptors exposed to an agonist which could modify cell responsiveness to successive extracellular stimuli over time. The receptor is first uncoupled from the G protein and then internalized to be recycled or degraded; thus, leading to the decrease of receptor number over the cell surface (14). Chronic exposure of neuronal cell lines expressing d and µ opioid receptors to selective agonists lead to an impaired activation of G proteins and decrease of opioid receptor number (17, 21-23). These phenomena can be classified as agonist-specific or homologous desensitization and down-regulation (14). Pei et al. (24) have related the d opioid receptor desensitization, due to a prolonged exposure to an agonist, with b adrenergic receptor kinase activity in a cellular model for G protein-coupled receptor regulation.

Moreover, Gucker and Biodlack (25) have reported that protein kinase C (PKC) activated physiologically may contribute in d opioid receptor down-regulation in NG 108-15 cells and phorbol esters, which stimulate PKC, attenuate opioid receptor function by altering the activity of the transducer Gi. Thus, these findings confirm that phosphorilation of target proteins, as well as uncoupling of the opioid receptor/G protein system and adaptations in the cAMP signal transduction cascade may represent essential steps for d opioid receptor desensitization and down-regulation (26). Conversely, heterologous desensitization indicates that the activation of one receptor may affect the response to distinct agonists binding to different receptor types (14).

Fig.2: DSLET- (DS) and D 9-THC-induced inhibition of forskolin-stimulated cAMP accumulation in NG 108-15 cells exposed for 0, 6 and 24 h to 100 nM D 9-THC. Cells were also exposed for 24 h to D 9-THC (100 nM) in presence of the antagonist SR 141716 A (SR; 1 µM). cAMP levels were evaluated in the absence (Ve) and presence of DS ranging from 0.1 to 100 nM (upper panel) or in the absence (Ve) and presence of D 9-THC ranging from 1 nM to 1 µM (lower panel). Control cells (indicated as untreated) were exposed to cell culture medium and 100 nM D 9-THC was added immediately before harvesting (see Materials and methods). The asterisks indicate data points that are significantly different (p < 0.01) from the corresponding values found in untreated cells not exposed to D 9-THC.

Therefore, the effects elicited by D 9-THC on its own receptor may be classified as homologous desensitization whereas those on d opioid receptor may be considered as heterologous desensitization and down-regulation. The prolonged exposure of the CB1 receptor to D 9-THC could activate several second messenger-dependent kinases which may phosphorilate not only the agonist-stimulated receptor but also other receptors leading to a significant loss of receptor functions. This hypothesis is supported by studies demonstrating that the activation of the CB1 receptor may modulates adenylyl cyclase activity and mitogen-activated protein kinase (27).

Fig. 3: Steady-state levels of d opioid receptor mRNA in NG 108-15 cells exposed for 24 h to 100 nM D 9-THC or previously treated with pertussis toxin (PT; 100 ng/ml for 24 h) or with the cannabinoid antagonist SR 141716A (SR; 1 µM) and then exposed to the cannabinoid for 24 h. Data were normalized against the ribosomal L19 mRNA used as internal control. Panel A : representative autoradiograms of a typical experiment. Panel B : Cumulative data (expressed as mean ± S.E.M.) from six independent experiments. *P<0.01 vs. control cells (indicated as Ve).

Therefore, different transduction pathways may be activated by D 9-THC which, in turn, could affect d opioid receptor responsiveness. Interestingly, desensitization of CB1 receptor following exposure to D 9-THC required a 6-h treatment while heterologous desensitization of dopioid receptors was observed after a longer period of time. Thus, it could be hypothesized that the two phenomena may involve different effector mechanisms.

Apparently, D 9-THC-induced d opioid receptor desensitization and down-regulation are not related to the increase of mRNA levels coding for this opioid receptor which was observed in NG 108-15 cells exposed for 24 h to the cannabinoid. It has been reported that in NG 108-15 cells chronically exposed to opioid agonists, the marked down-regulation of opioid receptors is not accompanied by significantly altered levels of the related mRNA (23). Thus, D 9-THC could affect d opioid receptor gene expression in an independent way.

In conclusion, present data demonstrate the existence, in NG 108-15 cells, of a complex cross-talk between the cannabinoid and opioid receptors on prolonged exposure to D 9-THC triggered by changes in signaling through Gi and/or G0-coupled receptors and add more evidence to the hypothesis of an interaction between the cannabinoid and opioid systems.

Acknowledgments

This study was supported by grants from C.N.R. to S.S. (n. 95.02937.CT14 and 96.03347.CT04) and by a special grant of the University of Bologna for the project "Sviluppo di Sonde Fluorescenti". We acknowledge the CIB of the University of Bologna for the use of the image analyzer and Sanofi Recherche (Montpellier, France) for kindly providing SR 141716A.

References

1. W.L. DEWEY, Pharmacol. Rev. 38 151-178 (1986).

2. C.C. FELDER, K.E. JOYCE, E.M. BRILEY, J. MANSOURI, K. MACKIE, O. BLOND, Y. LAY, A.L. MA and R.L. MITCHELL, Mol. Pharmacol. 48 443-450 (1995).

3. L.A. MATSUDA, S.J. LOLAIT, M.J. BROWNSTEIN, A.C. YOUNG and T. I. BONNER, Nature 346 561-564 (1990).

4. S. MUNRO, K.L. THOMAS and M. ABU-SHAAR, Nature 365 61-65 (1993).

5. P.B. SMITH, S.P. WELCH and B.R. MARTIN, J. Pharmacol. Exp. Ther. 268 1381-1387 (1994).

6. I. RECHE, J.A. FUENTES and M. RUIZ-GAYO, Eur. J. Pharmacol. 318 11-16 (1996).

7. S.N. THORAT and H.N. BHARGAVA, Eur. J. Pharmacol. 260 5-13 (1994).

8. H.N. BHARGAVA, Eur. J. Pharmacol. 36 259- 262 (1976).

9. J. CORCHERO, M.A. AVILA, J.A. FUENTES and J. MANZANARES, Life Sci. 61 PL39-43 (1997).

10. P. MAILLEUX and J.-J. VANDERHAEGHEN, Eur. J. Pharmacol. 261 R1-3 (1994).

11. A.C. HOWLETT, J.M. QUALY and L.L. KHACHATRIAN, Mol. Pharmacol. 29 307-313 (1986).

12. X. PAN, S.R. IKEDA and D.L. LEWIS, Mol. Pharmacol. 49 707-714 (1996).

13. M. SATOH and M. MINAMI, Pharmac. Ther. 68 343-364 (1995).

14. T.T. CHUANG, L. IACOVELLI, M. SALLESE and A. DE BLASI, Trends Pharmacol. Sci. 17 416-421 (1996).

15. P. J.-J. VAYSSE, E.L. GARDNER and R.S. ZUKIN, J. Pharmacol. Exp. Ther. 241 534-539 (1987).

16. M. RINALDI-CARMONA, F. BARTH, M.HEAULME, D. SHIRE, B. CALANDRA, C. CONGY, S. MARTINEZ, J. MARUANI, G. NEHAT, D. CAPUT, P. FENARA, P. SOUBRIE', J.C. BRELIERE and G. LE FUR, FEBS Lett. 350 240-244 (1994).

17. P.Y. LAW, D.S. HOM and H.H. LOH, Mol. Pharmacol. 22 1-4 (1982).

18. O.H. LOWRY, N.J. ROSEBROUGH, A.L. FARR and R.J. RANDALL, J. Biol. Chem. 193 265-275 (1951).

19. X. SU, T.F. SULLIVAN, S. BURSZTAJN and S. A. BERMAN, Biotechniques 17 734-736 (1994).

20. P.J. MUNSON and D. RODBARD, Anal. Biochem. 107 220-239 (1980).

21. L. L. WERLING, P.N. MCMAHON and B.M. COX, Proc. Natl. Acad. Sci. USA 86 6393-6397 (1989).

22. P.S. PUTTFARCKEN, L.L. WERLING and B.M. COX, Mol. Pharmacol. 33 520-527 (1998).

23. B. BUZAS, J. ROSENBERGER and B.M. COX, NeuroReport 7 1505-1508 (1996).

24. G. PEI, B.L. KIEFFER, R.J. LEIFKOWITZ and J.F. NEIL, Mol. Pharmacol. 48 173-177 (1995).

25. S. GUCKER and J.M. BIDLACK, Mol. Pharmacol. 42 656-665 (1992).

26. E.J. NESTLER, Neuron 16 897-900 (1996).

27. M. RINALDI-CARMONA, B. CALANDRA, D. SHIRE, M. BOUABOULA, D. OUSTRIC, F. BARTH, P. CASELLAS, P. FERRARA and G. LE FUR, J. Pharmacol. Exp. Ther. 278 871-878 (1996).

Corresponding Author : Santi Spampinato, Dept. Pharmacol., University of Bologna, Irnerio 48, 40126 Bologna, Italy. Fax : +39-51-248862 ; e-mail : spampi@biocfarm.unibo.it

Return to top of article